Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation

Heinz Lother (Curatore)

Rudolf Dernick (Curatore)

Springer-Verlag Berlin and Heidelberg GmbH & Co. KG, 2011

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...

• Curatore: Heinz Lother, Rudolf Dernick
• Editore: Springer-Verlag Berlin and Heidelberg GmbH & Co. KG
• Collana: Nato ASI Subseries H:
• Anno: 2011
• Rilegatura: Paperback / softback
• Pagine: 477 p.
• Dimensioni: 242 x 170 mm
• EAN: 9783642741999

Testo in English